T 1068/07 – It’s All In There

This is the (final) decision in the case that led to decision G 2/10 of the Enlarged Board (EBA)

Claim 1 of the main request before the Board read:

1. A catalytic DNA molecule having site-specific endonuclease activity specific for a nucleotide sequence defining a cleavage site in a preselected substrate nucleic acid sequence,

said catalytic molecule having first and second substrate binding regions flanking a core region,

said molecule having the formula:

5’ (X-R) - GGCTAGCT⁸ACAACGA - (X) 3’

wherein

each X is any nucleotide sequence,

(X-R) represents said first substrate binding region,

(X) represents said second substrate binding region,

R is a nucleotide capable of forming a base pair with a pyrimidine in the preselected substrate nucleic acid sequence,

T⁸ may be replaced by C or A,

said first substrate binding region having a sequence capable of binding through complementary base-pairing to a first portion of said preselected substrate nucleic acid sequence,

said second substrate binding region having a sequence capable of binding through complementary base-pairing to a second portion of said preselected substrate nucleic acid sequence,

with the proviso that said catalytic molecule is not a molecule in which the first and second binding regions can bind through complementary base-pairing to a substrate nucleic acid which is

5’ - GGAAAAAGUAACUAGAGAUGGAAG - 3’ (SEQ ID NO 135).

Here is what the Board had to say on A 123(2) related issues:

[1] According to the decision G 2/10 [order 1(a)] of the EBA , an amendment to a claim by a disclaimer disclaiming from it subject-matter disclosed in the application as filed infringes A 123(2) if the subject-matter remaining after the introduction of the disclaimer is not, be it explicitly or implicitly, directly and unambiguously disclosed to the skilled person using common general knowledge, in the application as filed.

[2] In order for the board to decide whether the main request fulfils the requirements of A 123(2), it is necessary to address the following questions:

i) is the subject-matter of the disclaimer introduced in claim 1 of the main request – either explicitly or implicitly – directly and unambiguously disclosed in the application as filed?, and

ii) is the subject-matter remaining in claim 1 of the main request after the introduction of the disclaimer in this claim – either explicitly or implicitly – directly and unambiguously derivable from the application as filed? […]

The disclosure of the application as filed

and the subject-matter of the disclaimer introduced in claim 1

[4] In its referral to the EBA (cf. T 1068/07), this board, albeit in a different composition, acknowledged that the subject-matter of the disclaimer present now in claim 1 of the main request was disclosed in the application as filed. As a formal basis for this disclaimer, the board explicitly referred to page 85, lines 2 to 26 and Figure 9 of the application as filed, which report the results obtained in Example 5 of the application as filed (cf. T 1068/07 [14]).

[5] As correctly stated by the appellant […], the application as filed discloses an in vitro evolution process for generating, selecting and isolating – intramolecular (cf. Examples 1 and 2) and intermolecular (cf. Examples 3 and 4) – catalytic DNA molecules having site-specific endonuclease activity specific for a nucleotide sequence defining a cleavage site in a preselected substrate nucleic acid sequence, and having first and second binding regions flanking a core region, wherein said first and second substrate regions have sequences capable of binding through complementary base-pairing to a first and a second portion, respectively, of said preselected substrate nucleic acid sequence.

[6] In Example 5, the preselected (all-RNA) substrate nucleic acid sequence was a stretch of 12-highly conserved nucleotides (SEQ ID NO: 49) embedded within a longer DNA molecule that included a stretch of 50 random nucleotides (N50) (SEQ ID NO: 50), which generated a population of putative enzymatic DNA molecules. After several rounds of in vitro evolution, enzymatic DNA molecules were selected for their ability to cleave a phosphoester within the embedded RNA target sequence. Several individual molecules from the population obtained after these rounds of in vitro selective amplification were cloned (cf. Tables 2 and 3) and their self-cleavage activity was measured. The self-cleavage reaction was easily converted to an intermolecular cleavage reaction by dividing the enzyme and substrate domains into separate molecules (cf. page 82, line 33 to page 83, line 1). Clone “10-23”, which was identified as having a high level of activity, was chosen, together with clone “8-17”, as a prototype molecule and characterized in detail, both structurally (nucleotide sequence, enzyme and substrate binding domains) and kinetically (cleavage site, turnover rates) (cf. Figure 8). The substrate binding arms of these molecules were further optimized by reducing them to 7 base-pairs on each side of the unpaired nucleotides demarcating the cleavage site (cf. Figure 9).

[7] The catalytic core region of clone “10-23” shown in Figures 8 and 9 of the application as filed falls within the more generic sequence SEQ ID NO: 122 referred to in original claim 1, which corresponds to the formula of the core region of claim 1 of the main request. The substrate nucleic acid sequence of clone “10-23”, referred to on page 85 of the application as filed, is also shown in Figures 8 and 9 (intramolecular and intermolecular, respectively) and is identical to the sequence SEQ ID NO: 135 of the disclaimer present in claim 1 of the main request.

[8] The board agrees with the appellant that the subject-matter of the disclaimer in claim 1 of the main request, namely the catalytic DNA molecules based on the “10-23” motif or prototype enzyme having a site-specific endonuclease activity specific for the substrate nucleotide sequence SEQ ID NO: 135, is explicitly disclosed in the application as filed.

The subject-matter remaining in claim 1 after introduction of the disclaimer

[9] Example 6 of the application as filed is directed to the preparation of “universal substrate enzymes” based on the “8-17” and “10-23” motifs described in the previous examples of the application as filed. In Example 6, it is explicitly stated that “(f)or both the 8-17 and 10-23 motif enzymes, the sequence of the substrate can be changed without loss of catalytic activity, so long as the substrate-binding arms of the enzyme were changed in a complementary manner” (cf. page 87, lines 24 to 28). Further studies were carried out in Example 6 in order to define more precisely the sequence requirements of the catalytic core of these DNA molecules and, as a result of these studies, the generic core region of the “10-23” motif was defined (cf. inter alia page 90, lines 26 to 29, page 96, lines 14 to 20, Figure 10 and original claim 1) and shown – by a survey of different combinations of RNA substrate and corresponding complementary DNA enzyme in the substrate binding region – to be generalizable with respect to any substrate sequence (cf. inter alia page 90, lines 29 to 33, page 92, line 23 to page 95, line 15, Table 4).

[10] It is in fact this very specific subject-matter, namely catalytic DNA molecules having the “10-23” core region of the formula found in claim 1 of the main request having site-specific endonuclease activity specific for any (preselected) substrate nucleotide sequence other than the substrate nucleotide sequence SEQ ID NO: 135, which actually remains in claim 1 of the main request after the introduction of the disclaimer in this claim.

[11] Thus, it follows from the above, that the criteria set out in point 1a of the Order of decision G 2/10 of the EBA […] are met by the disclaimer present in claim 1 of the main request and, accordingly, that this disclaimer fulfils the requirements of A 123(2).

Further objections raised under A 123(2)

[12] The appellant in the grounds of appeal protested against the inclusion of a section entitled “Final remarks not part of the present decision” in the appealed decision of the ED, wherein the ED raised several objections under A 123(2) […]. Nevertheless, the board referred to these objections in its communication pursuant to Article 15 RPBA […].

[13] Most of the remarks made, and objections raised, by the ED related to the Sequence Listing containing SEQ ID NO:1 to SEQ ID NO:150 (“463.4.TXT SEQUENCE LISTING”), which was filed by the applicant with its letter of 15 January 2004 in order to include all nucleotide sequences that were referred to in the application as filed but not present in the original Sequence Listing containing SEQ ID NO:1 to SEQ ID NO: 101 (cf. pages 99 to 140 of the application as filed). In its letter, the applicant explicitly stated that “To the best of my knowledge, the electronic form of the sequence listing corresponds to the printed form, and it does not include matter which goes beyond the content of the application as filed”. The board notes that the same objections were already raised – verbatim – by the ED in its communication of 8 August 2006 annexed to the summons to oral proceedings and they were specifically addressed in detail by the applicant in its reply of 19 December 2006 in preparation for the oral proceedings before the ED. Thus, none of the arguments put forward by the applicant has been discussed or even taken into account by the ED in the Section “Final remarks not part of the present decision” of the decision under appeal.

[14] The attention of the board has also been drawn to the “Decision of the President of the EPO dated 28 April 2011 on the filing of sequence listings” and to the “Notice from the EPO dated 28 April 2011 on the filing of sequence listings” (OJ EPO, 6/2011, pages 372 and 376, respectively) which specify the requirements for the filing of sequence listings in respect of European patent applications and the subsequent filing of sequence listings and further refer to previous decisions of the President of the EPO and previous notices from the EPO that have since been superseded.

[15] In view of the above considerations and taking into account that the objections raised by the ED concerning the Sequence Listing result from amendments made in the original description, which presumably will have to be adapted again after a complete examination by the first instance, the board refrains from making any further comments with respect to this issue. Nevertheless, it is noted that the disclaimer in claims 1 and 30 of the main request explicitly refers to SEQ ID NO: 135 and that the subject-matter of dependent claims 14 and 40 of the main request refers to SEQ ID NO: 102 to 109. Should these references not be in accordance with the above cited “Decision of the President of the EPO” and “Notice from the EPO”, these claims will have to be amended accordingly.

[16] In the section “Final remarks not part of the present decision” of the decision of the ED under appeal and in its letter of 8 August 2006 […], the ED raised an objection under A 123(2) with regard to the term “R” in claim 1 and to the specification of the cleavage site as being 5’ A-U 3’ in claim 3. These objections were addressed by the applicant in its letter of 19 December 2006, which, as acknowledged by the board in its communication pursuant to Article 15(1) RPBA […], indicated a basis for these features. Basis for other amendments introduced into the claims were indicated by the applicant in its letter of 30 May 2005, in particular with references to the original claims, the description and the Figures of the application as filed.

[17] No further objections under A 123(2) were raised by the ED nor has the board a reason to raise any of its own at this stage of the appeal proceedings.

Conclusion

[18] Thus, the subject-matter of claims 1 and 30 of the main request is considered to fulfil the requirements of A 123(2). […]

The decision under appeal is set aside and the case is remitted to the first instance for further prosecution on the basis of the main request […].

Should you wish to download the whole decision, just click here.

The file wrapper can be found here.