Tuesday, 31 July 2012

T 1068/07 – It’s All In There


This is the (final) decision in the case that led to decision G 2/10 of the Enlarged Board (EBA)

Claim 1 of the main request before the Board read:
1. A catalytic DNA molecule having site-specific endonuclease activity specific for a nucleotide sequence defining a cleavage site in a preselected substrate nucleic acid sequence,

said catalytic molecule having first and second substrate binding regions flanking a core region,

said molecule having the formula:

5’ (X-R) - GGCTAGCT8ACAACGA - (X) 3’

wherein

each X is any nucleotide sequence,

(X-R) represents said first substrate binding region,

(X) represents said second substrate binding region,

R is a nucleotide capable of forming a base pair with a pyrimidine in the preselected substrate nucleic acid sequence,

T8 may be replaced by C or A,

said first substrate binding region having a sequence capable of binding through complementary base-pairing to a first portion of said preselected substrate nucleic acid sequence,

said second substrate binding region having a sequence capable of binding through complementary base-pairing to a second portion of said preselected substrate nucleic acid sequence,

with the proviso that said catalytic molecule is not a molecule in which the first and second binding regions can bind through complementary base-pairing to a substrate nucleic acid which is

5’ - GGAAAAAGUAACUAGAGAUGGAAG - 3’ (SEQ ID NO 135).
Here is what the Board had to say on A 123(2) related issues:

[1] According to the decision G 2/10 [order 1(a)] of the EBA , an amendment to a claim by a disclaimer disclaiming from it subject-matter disclosed in the application as filed infringes A 123(2) if the subject-matter remaining after the introduction of the disclaimer is not, be it explicitly or implicitly, directly and unambiguously disclosed to the skilled person using common general knowledge, in the application as filed.

[2] In order for the board to decide whether the main request fulfils the requirements of A 123(2), it is necessary to address the following questions:

i) is the subject-matter of the disclaimer introduced in claim 1 of the main request – either explicitly or implicitly – directly and unambiguously disclosed in the application as filed?, and

ii) is the subject-matter remaining in claim 1 of the main request after the introduction of the disclaimer in this claim – either explicitly or implicitly – directly and unambiguously derivable from the application as filed? […]

The disclosure of the application as filed
and the subject-matter of the disclaimer introduced in claim 1

[4] In its referral to the EBA (cf. T 1068/07), this board, albeit in a different composition, acknowledged that the subject-matter of the disclaimer present now in claim 1 of the main request was disclosed in the application as filed. As a formal basis for this disclaimer, the board explicitly referred to page 85, lines 2 to 26 and Figure 9 of the application as filed, which report the results obtained in Example 5 of the application as filed (cf. T 1068/07 [14]).

[5] As correctly stated by the appellant […], the application as filed discloses an in vitro evolution process for generating, selecting and isolating – intramolecular (cf. Examples 1 and 2) and intermolecular (cf. Examples 3 and 4) – catalytic DNA molecules having site-specific endonuclease activity specific for a nucleotide sequence defining a cleavage site in a preselected substrate nucleic acid sequence, and having first and second binding regions flanking a core region, wherein said first and second substrate regions have sequences capable of binding through complementary base-pairing to a first and a second portion, respectively, of said preselected substrate nucleic acid sequence.

[6] In Example 5, the preselected (all-RNA) substrate nucleic acid sequence was a stretch of 12-highly conserved nucleotides (SEQ ID NO: 49) embedded within a longer DNA molecule that included a stretch of 50 random nucleotides (N50) (SEQ ID NO: 50), which generated a population of putative enzymatic DNA molecules. After several rounds of in vitro evolution, enzymatic DNA molecules were selected for their ability to cleave a phosphoester within the embedded RNA target sequence. Several individual molecules from the population obtained after these rounds of in vitro selective amplification were cloned (cf. Tables 2 and 3) and their self-cleavage activity was measured. The self-cleavage reaction was easily converted to an intermolecular cleavage reaction by dividing the enzyme and substrate domains into separate molecules (cf. page 82, line 33 to page 83, line 1). Clone “10-23”, which was identified as having a high level of activity, was chosen, together with clone “8-17”, as a prototype molecule and characterized in detail, both structurally (nucleotide sequence, enzyme and substrate binding domains) and kinetically (cleavage site, turnover rates) (cf. Figure 8). The substrate binding arms of these molecules were further optimized by reducing them to 7 base-pairs on each side of the unpaired nucleotides demarcating the cleavage site (cf. Figure 9).

[7] The catalytic core region of clone “10-23” shown in Figures 8 and 9 of the application as filed falls within the more generic sequence SEQ ID NO: 122 referred to in original claim 1, which corresponds to the formula of the core region of claim 1 of the main request. The substrate nucleic acid sequence of clone “10-23”, referred to on page 85 of the application as filed, is also shown in Figures 8 and 9 (intramolecular and intermolecular, respectively) and is identical to the sequence SEQ ID NO: 135 of the disclaimer present in claim 1 of the main request.

[8] The board agrees with the appellant that the subject-matter of the disclaimer in claim 1 of the main request, namely the catalytic DNA molecules based on the “10-23” motif or prototype enzyme having a site-specific endonuclease activity specific for the substrate nucleotide sequence SEQ ID NO: 135, is explicitly disclosed in the application as filed.

The subject-matter remaining in claim 1 after introduction of the disclaimer

[9] Example 6 of the application as filed is directed to the preparation of “universal substrate enzymes” based on the “8-17” and “10-23” motifs described in the previous examples of the application as filed. In Example 6, it is explicitly stated that “(f)or both the 8-17 and 10-23 motif enzymes, the sequence of the substrate can be changed without loss of catalytic activity, so long as the substrate-binding arms of the enzyme were changed in a complementary manner” (cf. page 87, lines 24 to 28). Further studies were carried out in Example 6 in order to define more precisely the sequence requirements of the catalytic core of these DNA molecules and, as a result of these studies, the generic core region of the “10-23” motif was defined (cf. inter alia page 90, lines 26 to 29, page 96, lines 14 to 20, Figure 10 and original claim 1) and shown – by a survey of different combinations of RNA substrate and corresponding complementary DNA enzyme in the substrate binding region – to be generalizable with respect to any substrate sequence (cf. inter alia page 90, lines 29 to 33, page 92, line 23 to page 95, line 15, Table 4).

[10] It is in fact this very specific subject-matter, namely catalytic DNA molecules having the “10-23” core region of the formula found in claim 1 of the main request having site-specific endonuclease activity specific for any (preselected) substrate nucleotide sequence other than the substrate nucleotide sequence SEQ ID NO: 135, which actually remains in claim 1 of the main request after the introduction of the disclaimer in this claim.

[11] Thus, it follows from the above, that the criteria set out in point 1a of the Order of decision G 2/10 of the EBA […] are met by the disclaimer present in claim 1 of the main request and, accordingly, that this disclaimer fulfils the requirements of A 123(2).

Further objections raised under A 123(2)

[12] The appellant in the grounds of appeal protested against the inclusion of a section entitled “Final remarks not part of the present decision” in the appealed decision of the ED, wherein the ED raised several objections under A 123(2) […]. Nevertheless, the board referred to these objections in its communication pursuant to Article 15 RPBA […].

[13] Most of the remarks made, and objections raised, by the ED related to the Sequence Listing containing SEQ ID NO:1 to SEQ ID NO:150 (“463.4.TXT SEQUENCE LISTING”), which was filed by the applicant with its letter of 15 January 2004 in order to include all nucleotide sequences that were referred to in the application as filed but not present in the original Sequence Listing containing SEQ ID NO:1 to SEQ ID NO: 101 (cf. pages 99 to 140 of the application as filed). In its letter, the applicant explicitly stated that “To the best of my knowledge, the electronic form of the sequence listing corresponds to the printed form, and it does not include matter which goes beyond the content of the application as filed”. The board notes that the same objections were already raised – verbatim – by the ED in its communication of 8 August 2006 annexed to the summons to oral proceedings and they were specifically addressed in detail by the applicant in its reply of 19 December 2006 in preparation for the oral proceedings before the ED. Thus, none of the arguments put forward by the applicant has been discussed or even taken into account by the ED in the Section “Final remarks not part of the present decision” of the decision under appeal.

[14] The attention of the board has also been drawn to the “Decision of the President of the EPO dated 28 April 2011 on the filing of sequence listings” and to the “Notice from the EPO dated 28 April 2011 on the filing of sequence listings” (OJ EPO, 6/2011, pages 372 and 376, respectively) which specify the requirements for the filing of sequence listings in respect of European patent applications and the subsequent filing of sequence listings and further refer to previous decisions of the President of the EPO and previous notices from the EPO that have since been superseded.

[15] In view of the above considerations and taking into account that the objections raised by the ED concerning the Sequence Listing result from amendments made in the original description, which presumably will have to be adapted again after a complete examination by the first instance, the board refrains from making any further comments with respect to this issue. Nevertheless, it is noted that the disclaimer in claims 1 and 30 of the main request explicitly refers to SEQ ID NO: 135 and that the subject-matter of dependent claims 14 and 40 of the main request refers to SEQ ID NO: 102 to 109. Should these references not be in accordance with the above cited “Decision of the President of the EPO” and “Notice from the EPO”, these claims will have to be amended accordingly.

[16] In the section “Final remarks not part of the present decision” of the decision of the ED under appeal and in its letter of 8 August 2006 […], the ED raised an objection under A 123(2) with regard to the term “R” in claim 1 and to the specification of the cleavage site as being 5’ A-U 3’ in claim 3. These objections were addressed by the applicant in its letter of 19 December 2006, which, as acknowledged by the board in its communication pursuant to Article 15(1) RPBA […], indicated a basis for these features. Basis for other amendments introduced into the claims were indicated by the applicant in its letter of 30 May 2005, in particular with references to the original claims, the description and the Figures of the application as filed.

[17] No further objections under A 123(2) were raised by the ED nor has the board a reason to raise any of its own at this stage of the appeal proceedings.

Conclusion

[18] Thus, the subject-matter of claims 1 and 30 of the main request is considered to fulfil the requirements of A 123(2). […]

The decision under appeal is set aside and the case is remitted to the first instance for further prosecution on the basis of the main request […].

Should you wish to download the whole decision, just click here.

The file wrapper can be found here.

Monday, 30 July 2012

G 1/10 – Unavailable


Here is the latest decision by the Enlarged Board, on corrections under R 140.

The underlying case was as follows:

The opposition (filed on September 10, 2004) had been based on the sole ground of added subject-matter (A 100(c)), the only argument being that in claim 1 of the patent the feature
“means for initiating (56) a command related to a position of the device data”
was not disclosed in the application as filed. The proprietor’s reply of 27 April 2005 argued that this resulted from a typographical error made when amending claim 1 during the pre-grant procedure and that the feature should read
“means for initiating (56) a command related to a portion of the device data”.
The word “position” should thus read “portion”.

On December 27, 2005, the proprietor requested that the opposition proceedings be stayed and that the case be remanded to the Examining Division (ED) for re-issuance of the granted patent after correction under R 89 EPC 1973. On November 2, 2006 a formalities officer acting for the Opposition Division (OD) issued a communication stating that the case was referred to the ED and that examination of the opposition was adjourned pending the final decision of the ED.

The opponent filed an appeal which was rejected as inadmissible by Board 3.5.03 in its decision T 165/07 of November 23, 2007. The Board considered that the formalities officer’s communication did not constitute a decision within the meaning of A 106(1) EPC 1973 and that the OD had not yet taken a decision on the proprietor’s request to stay the opposition proceedings and to remit the case to the examination division for a decision on the request for correction under R 89 EPC 1973.

On March 12, 2009 the OD took the interlocutory decision to stay opposition proceedings, to remit the case to the ED for a decision on the request for correction under R 140 (which corresponds to R 89 EPC 1973), and to allow a separate appeal against this decision. The opponent appealed against that decision.

In 2010, Board 3.5.03 (case T 1145/09) referred the following questions to the Enlarged Board (EBA) :
1. Is a patent proprietor’s request for correction of the grant decision under R 140 which was filed after the initiation of opposition proceedings admissible? In particular, should the absence of a time limit in R 140 be interpreted such that a correction under R 140 of errors in decisions can be made at any time?

2. If such a request is considered to be admissible, does the ED have to decide on this request in ex parte proceedings in a binding manner so that the OD is precluded from examining whether the correction decision amounts to an unallowable amendment of the granted patent?
The answer of the EBA is very straightforward:

Since R 140 is not available to correct the text of a patent, a patent proprietor’s request for such a correction is inadmissible whenever made, including after the initiation of opposition proceedings.

If you want to know the reasons for the answer, here we go:

[1] The EBA agrees with the referring board’s decision […] that the referred questions relate to a decisive issue in the case before it concerning the interpretation of R 140, the delimitation of the respective competences of the ED and OD, and the possible intercalation of ex parte and inter partes proceedings. The procedural provisions of the EPC are silent on these issues and the case law of the boards of appeal is at least partly divergent […]. Thus the present referral is admissible as it serves both the purposes mentioned in A 112(1)(a), namely ensuring uniform application of the law and addressing points of law of fundamental importance.

[2] R 140 reads:
“In decisions of the EPO, only linguistic errors, errors of transcription and obvious mistakes may be corrected.”
This is exactly the same wording as the previous R 89 EPC 1973. Accordingly, while both are referred to herein, no distinction is made between the present and previous rules or between the case law relating to one or other of them.

[3] The referred questions use the expression “request for correction of the grant decision under R 140” and therefore this decision is not concerned with corrections of any other decisions. Further, even in the context of corrections of grant decisions, it is clear that the referring decision is concerned only with the text of patents which are treated as an integral part of grant decisions by reason of being referred to in communications under R 71(3) (see T 850/95 [2]). Accordingly this decision is further confined to corrections of patents themselves - to the description, claims and drawings (often called the “patent documents”). Such patent documents have the particular characteristics that they are not only supplied by a patent applicant but also that they may only be the subject of a decision to grant if approved by the applicant (see A 113(2) and R 71 EPC and point [10] below). The EBA’s decision is therefore limited to corrections within grant decisions of the description, claims and drawings and references in these reasons to “patent corrections” or “correcting patents” are also so limited.

[4] It also follows from this limitation of the present reasons to such patent corrections that, among other possible corrections to grant decisions, the EBA is not here concerned with corrections to bibliographic data and need not therefore comment on situations such as that described in the submissions of the second amicus curiae […]. R 71(3) has been amended with effect from 1 April 2012 (OJ EPO 2010, 637) so as to extend its scope to bibliographic data which is also to be sent to the applicant (thereby codifying the EPO’s previous practice). Since both the text in which the ED intends to grant the patent and the related bibliographic data are mentioned in the amended R 71(3) as separate entities, it is clear that under the amended Rule bibliographic data still do not form part of the text of the patent.(Subsequent references to R 71 are to the Rule prior to that amendment).

[5] As the EBA observed in decision G 1/97 [3(c)] by reference to the travaux préparatoires, legal certainty and the prevention of adverse effects on third parties are the reasons for the narrow ambit of allowable corrections under R 140 (then R 89 EPC 1973):
“The travaux prĂ©paratoires concerning R 89 also show that the legislator was particularly concerned with the protection of third parties. This is evident from the history of R 89, which emerged from a draft version of A 159(a) (see BR/49 d/70, page 9) incorporated in the draft Implementing Regulations of April 1972 under A 91(1) (see BR/185 d/72) which deals with the correction of procedural errors as long as this does not adversely affect the interests of, inter alia, third parties. Finally, it was decided that R 89 should be limited to its present, narrow wording, which rules out any possibility of such adverse effect.”
In the EBA’s judgment R 140 is not available to correct patents. This is consistent with the wish to rule out any possibility of adverse effects as expressed in its earlier opinion cited above. There are several reasons, all of which reflect the need for legal certainty and the protection of third parties, why this should be so (see points [6-8] below) while patent proprietors none the less have adequate remedies available, both before and after grant, to ensure that the text of their patents is correct (see points [9-13] below). The non-availability of R 140 to correct patents means that the EBA, while agreeing with the statement in decision T 850/95 […] that patent documents referred to in a grant decision become an integral part of the decision, does not agree with the subsequent conclusion that errors in those documents may subsequently be corrected under R 140 (or R 89 EPC 1973 which was in effect at the time of decision T 850/95 – see OJ EPO 1996, 455, point [2, final sentence]).

[6] Legal certainty is served by the grant decision establishing a definitive text of a patent for the purposes of any subsequent proceedings, whether at national or EPO level. As from its grant, a European patent ceases to be within the jurisdiction of the EPO and becomes, subject only to the possibility of later EPO proceedings by way of opposition or limitation, a bundle of national patents each of which falls within the exclusive jurisdiction of a designated Contracting State (see A 2(2)).

One necessary corollary of the decision to grant is that the EPO is no longer competent to deal with any further matters relating to the text of the patent (see decision T 777/97 [3]). A further corollary of the grant decision is that, according to A 70(1) and subject to A 70(3), the courts and other authorities of each designated Contracting State are entitled, indeed required, to take the text of the granted patent as the basis of any national proceedings. Since, apart from any later opposition or limitation proceedings, the patent is then subject to the exclusive jurisdiction of those Contracting States, there is no reason why any subsequent decision of the EPO (other than in opposition or limitation proceedings) to change the text of the granted patent should be recognised in those jurisdictions. Since, territorial scope apart, the powers of national courts and the OD correspond to each other (see A 100 and A 138), it would follow that the text of an opposed patent should also be in the form as granted.

[7] As regards third parties, including potential opponents, none of the concerns with the present practice expressed in the President’s comments and, to a lesser extent, in the referring decision can arise if there is no possibility of recourse to R 140 to correct patents […]. Thus there will be no delay in opposition proceedings caused by requests under R 140 and no decisions on corrections not subject to appeal by an opponent. There will be no adverse effects on third parties who, relying on a patent as granted, undertake activities which later infringe a patent as corrected. There will be no would-be opponents who, relying on the granted claims, decide not to file an opposition only to find that, after correction, they are threatened by the patent but deprived of the possibility of opposition. And there will be no question of denying the principle of equal treatment of parties through the possibility for a patentee to turn inter partes proceedings into ex parte proceedings on an issue – the content of the patent – which is decisive for an opposition.

[8] Further, the EBA considers that the absence of a possibility to request patent corrections under R 140 should not prejudice patent proprietors. If on the one hand a correction would be obvious (as it should be to satisfy R 140) then, as the respondent proprietor submitted […], there can be no surprise and no adverse effect on opponents or others, because all concerned should read the patent as if corrected and an actual correction should not be necessary. If on the other hand a correction would be less than immediately obvious, then it should not in any event be allowed under R 140 which is confined to correction of “obvious mistakes”.

[9] In the EBA’s judgment a patent applicant (or, subsequently, a patent proprietor) has adequate means at his disposal to ensure his patent as granted is in the exact form he wants it to be without any need to invoke R 140. Should an applicant, at any stage up to and including the final approval by him of the text of his patent, make a mistake (or overlook a mistake he has previously made) in a document he has filed – for example, he mis-spells a word or uses an incorrect word in an amended claim which he files in the course of examination proceedings – then before grant that mistake can be corrected under R 139 on request.

[10] Further, a patent applicant is obliged to approve the text in which his patent is to be granted (see A 97(1) and R 71(3)(4) and (5)). He must be informed of the text in which the ED intends to grant a patent and is deemed to approve that text if he proceeds to pay the requisite fees and file translated claims within a period of four months (see R 71(3)). Otherwise he must within that four month period request amendments or corrections (see R 71(4), which specifically mentions “correction of errors under R 139”); and there is also a procedure for further amendment and approval in the event those first amendments or corrections are not consented to by the ED (see R 71(5)).

[11] If, given the opportunity to check the patent text before approving it, an applicant does not draw any errors to the attention of the ED and thus ensure his approval is limited to the correct text, then the responsibility for any errors remaining in that text after grant should be his alone, whether the error was made (or introduced) by him or by the ED.

Thus, for example, the responsibility for a mis-spelt or incorrect word in an amended claim in the approved text is from this point in time entirely that of the patent applicant and it would be illogical thereafter to impute that mistake to the ED – by suggesting the ED did not intend to make a decision which in fact included the very text approved by the applicant himself – in order to bring the applicant’s own error within the ambit of R 140. The President’s comments […] referred to the practice of some applicants who turn to R 140 to request the correction of obvious errors when this is no longer possible under R 139. That practice suggests some patent applicants seek to rely on R 140 to “tidy up” their own errors by the fiction of ascribing them to the ED. As epi correctly observed […], R 140 is intended for correcting errors in decisions of the EPO and not errors in documents filed by a patent applicant or proprietor. It would follow from the non-availability of R 140 to correct patents that this practice should cease.

[12] If however the ED proceeds to make a decision to grant which contains an error subsequently made by it, so that the granted text is not that approved by the proprietor, then the proprietor is adversely affected by that decision and is entitled to appeal.

If, for example, the text of the patent which is the subject of the decision to grant includes an amended claim which has after approval been erroneously changed by the ED, then the patent proprietor can demonstrate that the ED did not grant his patent with the text approved by him. It must then follow that the ED failed to observe A 113(2) and the appeal should succeed by allowing interlocutory revision and reimbursement of the appeal fee as being equitable in view of the ED’s mistake (see respectively A 109(1) and R 103(1)(a)).

[13] The referring decision relates to opposition proceedings. The EBA considers R 140 is not available for correcting patents, including during opposition or limitation proceedings. However, it is always open to a patent proprietor to seek to amend his patent during opposition or limitation proceedings and such an amendment could remove a perceived error. Such an amendment would have to satisfy all the legal requirements for amendments including those of A 123.

Being a request for an amendment under A 123 and not a request for a correction under R 140, and thus a normal incident of the opposition or limitation proceedings, no question arises as to which body is competent to deal with the request. In the case of opposition proceedings, the amendment will be considered and decided by the OD (see A 19(1) and A 100), in the case of limitation proceedings by the ED (R 91 and R 95(2)(3)(4)).

[14] The first referred question asked whether a patent proprietor’s request for correction of the grant decision under R 140 which was filed after the initiation of opposition proceedings is admissible. Since the EBA considers that R 140 is not available to correct granted patents, it follows that a request for such a correction under R 140 filed is inadmissible.

[15] The subsidiary part of the first referred question asked whether, in particular, the absence of a time limit in R 140 should be interpreted such that a correction under R 140 of errors in decisions can be made at any time. It follows from the EBA’s opinion that, as regards corrections of patents, R 140 is not available at all.

[16] It was a condition precedent of the second referred question that a request for correction of a grant decision under R 140 filed after the initiation of opposition proceedings should be considered admissible. Since, as stated above, the EBA does not consider such a request admissible at all, no answer to the second referred question is required. […]

For these reasons, it is decided that:

1. Since R 140 is not available to correct the text of a patent, a patent proprietor’s request for such a correction is inadmissible whenever made, including after the initiation of opposition proceedings.

2. In view of the answer to the first referred question, the second referred question requires no answer.

Should you wish to read the whole decision, just click here.

The file wrapper can be found here.

Saturday, 28 July 2012

Interpretative Spotlight: “Gradually”


This is an appeal against a refusal of an application.

The single claim according to the request submitted during the oral proceedings (OPs) before the Board read as follows:
1. A gas turbine engine comprising a plurality of blades, each blade comprising:
a platform (52);
a shank (54) extending from the platform;
a dovetail (56) extending between an end (101) of the blade and said shank for mounting said blade within the gas turbine engine, said dovetail comprising at least one tang (86);
an airfoil (50) comprising a first sidewall (60) and a second sidewall (62) extending in radial span between said platform and a blade tip (70); and, a cooling cavity (102) in the blade that extends through the airfoil, the platform, the shank, and the dovetail, wherein the portion of the cavity defined within the dovetail includes a root passage section (120) having a first width (DR), and a transition passage section (122) that extends between the root passage section and the portion (114) of the cavity defined within the shank, and wherein the portion of the cavity defined within the shank has a second width (DS) that is larger than the root passage section first width (DR); wherein the root passage section first width (DR) is substantially constant within the root passage section (120) and the transition passage section (122) is tapered between the root passage section and the portion (114) of the cavity defined within the shank (54), such that the width of the transition passage section (DT) tapers outwardly between the root passage section and the shank portion; and
a coating on the inner surface (104) of the blade that defines the cooling cavity, the coating being an oxidation resistant environmental coating (105), characterized in that
at least a portion of said cooling cavity has a coating having a thickness greater than 0.0254 mm (0.001 inches), and in that
the inner surface (104) of the cooling cavity (102) is defined with an arcuate interface (156) having a predefined radius between the transition passage section (122) and the root passage section (120) of the cavity, wherein the combination of transition passage section length (146) and the arcuate interface (156) enables the transition passage section (122) to taper gradually outward between the root passage section (120) and the shank portion (114), and with an arcuate interface (170) between the transition portion (122) and the shank portion (114) of the cavity, and wherein the transition passage length (146) enables the arcuate interface (170) to be defined between the transition passage section (122) and the shank portion (114). (my emphasis)

The Board found this claim to lack clarity:

[1] Claim 1 of the sole request submitted during the OPs does not meet the requirements of Article 84 EPC 1973. In particular, the feature “wherein the combination of transition passage section length (146) and the arcuate interface (156) enables the transition passage section (122) to taper gradually outward between the root passage section (120) and the shank portion (114)” lacks clarity.

[1.1] This feature has been taken almost literally from page 7 of the description of the only preferred embodiment of the invention, illustrated in Figure 3. The relative term “gradually”, which has no well-defined meaning in the art, is not further defined in the description of in this embodiment. Its meaning can be understood however in comparison to the abrupt transition between the corresponding sections in the blade of the prior art shown in Figure 5.


[1.2] The appellant’s construction of the feature “taper gradually outward” relies on a comparison of the taper angles of the transition passage section in a blade of the preferred embodiment of the invention (Fig. 3) with an angle of the corresponding section in a prior art blade (Fig. 5). In these two blades, the respective diameters of the adjacent root passage section DR, and the shank portion DS, are shown to be essentially unchanged. The length of the transition passage section is altered and the sharp corners at both ends of the transition passage section of the prior art blade are replaced by arcuate interfaces in the blade according to the embodiment of the invention. By comparing the two blades of these Figures indeed the outwardly tapering transition passage section of the preferred embodiment of the invention is longer and therefore, by joining at their ends the respective root passage section and shank portion, leads to a less abrupt or more shallow taper angle compared to that in Figure 5. However, the subject-matter of the claim does not refer to any prior art blade, so that the feature “taper gradually outward” remains vague and without precise meaning.

[1.3] Even if it were assumed that the skilled person would, from the present wording of the claim, understand the feature “to taper gradually outward” in the sense of a more shallow taper angle compared to the prior art disclosed specifically in Figure 5, it would remain entirely unclear where the limit lies, for example in terms of degrees of an angle, between an abrupt transition, of the prior art, and a gradual transition as intended by the claimed subject-matter. The application does not disclose any absolute or relative dimensions of the geometry of the cooling cavities’ various sections for the blade according to the embodiment of the invention or the prior art blade. The appellant was also unable to provide any indication where such a limit between the prior art and the claimed subject-matter should be drawn, nor could the Board itself determine any disclosure in the application which would clarify this. The comparison of the length of the transition passage sections and consequently the meaning to be given to the feature “taper gradually outward” relies thus on unspecified dimensional relationships of a non-standardised prior art blade having a particular cooling cavity geometry with an allegedly abrupt transition. The feature consequently does not allow a skilled person to understand with any clarity what is meant by this feature of the claim.

[2] According to Article 12(2) RPBA the grounds of appeal shall contain a party’s complete case. Article 13(1) RPBA sets out that any amendment to the party’s case may be admitted and considered at the Board’s discretion. The discretion shall be exercised in view of the complexity of the new subject-matter submitted, the current state of the proceedings and the need for procedural economy. In order to be in line with the requirement of procedural economy, a request filed at a late stage of the procedure should be prima facie allowable in the sense that it overcomes the objections raised against previous requests and does not introduce new objections.

Since the claim of the sole request submitted during the OPs does not meet the requirement of A 84 EPC 1973, this request is not prima facie allowable in the aforementioned sense. It was thus not admitted into the proceedings.

[3] Since the only request on file was not admitted, the appeal could not be allowed since there was no request in proceedings upon which grant of a patent could be based. […]

The appeal is dismissed.

Should you wish to download the whole decision (T 1075/10), just click here.

The file wrapper can be found here.

Friday, 27 July 2012

T 936/09 – A Deliberate Choice


This is an appeal against the revocation of the opposed patent by the Opposition Division (OD).

About one month after the notice of opposition had been filed, the EPO sent a communication (dated April 23, 2007) inviting the patent proprietor to file its observations within a period of four months. Upon request from the patent proprietor, this time limit was extended by two months, but the patent proprietor still failed to respond. The EPO then issued another communication (dated December 13, 2007) setting a two-month period for further action on behalf of the patent proprietor. On March 10, 2008, the latter sent a fax, which read:
“For the attention of the OD

Dear Sirs,

Re: European Patent Application […]

Reference is made to your Communication dated December 13, 2007.

Please be informed that the Applicant [sic] is interested in maintaining the Patent, but will not reply to the Notice of Opposition filed by Brose on April 23, 2007.”
The patent proprietor did not request oral proceedings (OPs) in the first-instance proceedings. Nor did it file any amended claims or further submissions on matters of substance.

By a decision of the OD posted on 17 February 2009 the patent was revoked under A 101(2), for lack of novelty over documents D5 and D6. This decision was issued without prior OPs or a prior communication to the parties from the OD.

The patent proprietor filed an appeal as well as amended claims.

Those who have followed the recent case law will not be surprised that the Board found these claims to be inadmissible:

[2] According to the principles developed by the Enlarged Board of Appeal, the appeal procedure is to be considered as a judicial procedure (G 1/99 [6.6], G 8/91 [7]). Appeal proceedings are wholly separate and independent from the preceding, purely administrative, first-instance proceedings and not a mere continuation of those first-instance proceedings (see e.g. T 34/90 [2]). The function of appeal proceedings is to give a judicial decision upon the correctness of a separate earlier decision taken by a first-instance department (see e.g. T 34/90, G 9/91 and G 10/91). It follows that the purpose of the inter partes appeal procedure is mainly to give the losing party a possibility to challenge the decision of the OD on its merits and to obtain a judicial ruling on whether the decision of the OD is correct (G 9/91 and G 10/91 [18]). The appeal proceedings are thus largely determined by the factual and legal scope of the preceding opposition proceedings and the parties have only limited scope to amend the subject of the dispute in second-instance proceedings (T 1705/07 [8.4]). It is not the purpose of the appeal to conduct the case anew and, therefore, the issues to be dealt with in appeal proceedings are determined by the dispute underlying the opposition proceedings (see e.g. T 356/08 [2.1.1]). Thus the appeal proceedings are not just an alternative way of dealing with and deciding upon an opposition. Parties to first-instance proceedings are therefore not at liberty to shift their case to the second instance as they please, thereby compelling the board of appeal either to give a first ruling on the critical issues or to remit the case to the department of first instance (see also T 1067/08 [7.2]). The filing of new submissions (requests, facts or evidence) by a party are not precluded in appeal proceedings, but their admission is restricted, depending inter alia on the procedural stage at which the submissions are made (see e.g. T 356/08 [2.1.1], T 1685/07 [6.4]; Brigitte GĂ¼nzel, “The treatment of late submissions in proceedings before the boards of appeal of the EPO”, Special edition OJ EPO 2/2007, 30).

[3] The afore-mentioned principles are reflected in the provisions of Articles 12(4) and 13 RPBA. Since the [patent proprietor] filed its main request with its statement of grounds of appeal, Article 12(4) RPBA is the relevant provision to be applied in the present case.

[4] Article 12(4) RPBA requires the board to take into account everything presented by the parties under Article 12(1) RPBA if and to the extent that it relates to the case under appeal and meets the requirements in Article 12(2) RPBA. However, according to Article 12(4) RPBA, the board has the discretionary power to hold inadmissible facts, evidence or requests which could have been presented or were not admitted in the first-instance proceedings. This discretionary power serves the purpose of ensuring a fair and reliable conduct of judicial proceedings (T 23/10 [2.4]).

[5] It follows from the above that a party to appeal proceedings has no right to have a request which could have been filed in first-instance proceedings but was only filed with the statement setting out the grounds of appeal admitted into appeal proceedings (see also e.g. R 10/09 [3.2]; R 11/11 [9]; T 144/09 [1.14]). Consequently, a patent proprietor who files such a request cannot defend its patent on the basis of that request in appeal proceedings if the board, exercising its discretion under Article 12(4) RPBA, holds it inadmissible.

[6] According to established jurisprudence, discretion has to be exercised equitably, i.e. all relevant factors which arise in a case have to be considered, taking into account the particular circumstances of the case (G 7/93 [2.5]; R 11/11 [9]; T 931/06 [3.5]; T 23/10 [2.3]).

[7] In the first-instance proceedings of the present case the patent proprietor reacted to the opposition filed against its patent only after receipt of several EPO communications […] and in a very restricted manner. The patent proprietor merely stated that it was interested in maintaining the patent as granted and that it would not reply to the notice of opposition […]. In fact the patent proprietor did not file any further submissions, such as arguments or requests, in the course of the first-instance proceedings, despite being given several opportunities to do so […]. Indeed, in the whole course of the first-instance proceedings, the patent proprietor did not take the opportunity to defend its patent as granted or in amended form in writing. Nor did the patent proprietor file a request for OPs, with the result that the OD was not obliged to hold OPs in case of a revocation of the patent. Although it is true that not requesting OPs is not a waiver of the right to file submissions, it does, however, amount to dispensing with presenting the case orally during OPs. In the board’s view, by its conduct in the first-instance proceedings the patent proprietor thus made a “considered and deliberate choice” not to submit any arguments or amended claims, or any further requests in the first-instance proceedings in writing or orally, despite being given the opportunity to do so.

In this respect the present case is indeed comparable to case T 144/09, in which the patent proprietor did not avail himself of the opportunity to file any request which could have overcome one of the grounds for opposition, despite being given the opportunity to do so in OPs before the OD (see T 144/09 [IV; 1.4-18]), and therefore made a “considered and deliberate choice” not to file an amended request in those proceedings (see T 144/09 [1.14]). The board notes that, according to the facts of T 144/09, the patent proprietor had not explicitly stated in that case that he would not file any further request. However, the present board does not consider it necessary that such a choice is explicitly stated.

[8] The board considers the patent proprietor’s conduct in the first-instance opposition proceedings particularly significant since a patent proprietor usually files at least arguments as to why the grounds for opposition raised do not prejudice the maintenance of the granted patent if he wants to maintain his patent in that form, and/or he amends his patent if he (also) wants to defend a limited version of his patent.

[9] However, under the EPC, there is no legal obligation for the patent proprietor to take an active part in opposition proceedings. To that extent, the board agrees with the [patent proprietor]. But the board does not accept that the patent proprietor is free to present or complete his case at any time that he wishes during the opposition or opposition appeal proceedings, depending, for example, on his procedural strategy or his financial situation.

This view is in line with the provisions of A 114(2) EPC (and A 114(2) EPC 1973) and of Articles 12(4) and 13 RPBA, which give a discretion to the deciding body not to admit a party’s submissions filed at a late stage of proceedings.

In particular, in view of the judicial nature and purpose of inter partes appeal proceedings […] and in the interests of an efficient and fair procedure, the board considers it necessary that all parties to opposition proceedings complete their submissions during the first-instance proceedings in so far as this is possible. If a patent proprietor chooses not to respond in substance at all to the opposition, for example by filing arguments or amended claims, or chooses not to complete his submissions at the stage of the first-instance proceedings, but rather presents or completes his case only in the notice of appeal or the statement setting out the grounds of appeal, then he will need to face the prospect of being held to account for such conduct by the board when, for example, exercising its discretion under Article 12(4) RPBA.

[10] The board turns now to the [patent proprietor’s] argument that, as in case T 848/09, the reasons for the patent being revoked were not known to the patent proprietor until the decision under appeal was notified to the parties, because the OD had not held OPs or issued a preliminary opinion before notifying its decision. This argument does not convince the board. First, the notice of opposition clearly indicated the grounds for opposition, together with the supporting evidence and submissions, and the patent proprietor should have expected that the ground(s) for opposition raised in the notice of opposition would most probably be dealt with in the decision of the OD. Second, the board agrees with the [opponent] that there is nothing in the decision under appeal which goes beyond the content of the notice of opposition. This has also not been contested by the [patent proprietor] […]. Thus all the reasons for revocation of the opposed patent were known to the patent proprietor before it received the impugned decision. Consequently, the facts of the present case differ from those in case T 848/09, in which the competent board concluded that the reasons for revocation had not been explicitly made known to the patent proprietor and therefore that it was plausible that the formulation of a suitable new request overcoming the objection was not immediately evident to the patent proprietor at OPs before the OD.

[11] Since the reasons for revocation of the patent were known to the patent proprietor before the OD notified its decision, the board does not accept the [patent proprietor’s] argument that the appeal proceedings were the first possibility to file amended claims suitable to overcome the reasons for revocation of the opposed patent. Moreover, the patent proprietor was given several opportunities to meet the grounds for opposition […]. Instead of not taking the opportunity to defend its patent in the first-instance proceedings, the patent proprietor could at that stage have filed a request in the form of that filed with the statement setting out the grounds of appeal. That this could have been done is also supported by the [patent proprietor’s] submission that the present main request is a straightforward limitation of the granted claims which took into consideration the reasons for revocation of the patent given by the OD. The [patent proprietor’s] argument that the present main request was “a direct reaction to the reasons for revocation given by the OD” does not alter the board’s view since, as explained above, these reasons were essentially the same as the objections raised in the notice of opposition. Furthermore, the [patent proprietor’s] motives for not limiting its patent in the first-instance proceedings in view of the objections raised in the notice of opposition are not a valid reason for accepting that the [patent proprietor] could not have filed the present main request in the proceedings before the OD. Even if the patent proprietor did think that these objections would not be relevant to the granted patent and for that reason did not file amended claims in the first-instance proceedings, this does not mean that it could not have done so.

[12] The [patent proprietor’s] further argument that after the patent proprietor’s reply of 10 March 2008 to the EPO communications there was no indication at all that the OD would issue the impugned decision is not convincing either. As the [opponent] pointed out, the EPO communication dated 13 December 2007 contained the information that it was likely that, if the patent proprietor did not react within the period specified in that communication, the opposition proceedings would be continued pursuant to A 101. Since, in its reply to that communication, the patent proprietor clearly indicated that it would not reply to the notice of opposition and did not request OPs, it should not have come as a surprise to the patent proprietor that the OD continued the examination of the opposition and proceeded directly to issue the written decision. The board also agrees with the [opponent] that there was no surprising element as far as the time of notification of the impugned decision is concerned because there was indeed a period of almost two years between the filing of the notice of opposition and the notification of the decision under appeal as well as a period of about one year between the patent proprietor’s reply to the EPO communication and the notification of the decision under appeal.

[13] Finally, the board turns to the [patent proprietor’s] argument that in fact there had been no further opportunity for the patent proprietor to react to any opinion of the OD by filing amended claims in the first-instance proceedings. The board does not find this argument persuasive, since there was no reason for the OD to give an opinion on the opposition before taking its decision in view of the course of the first-instance proceedings as set out above (see point [7] above).

[14] In view of the foregoing, the board concludes that the present main request could already have been filed in the first-instance proceedings in response to the objections raised in the notice of opposition. Hence the board does not accept the [patent proprietor’s] argument that the provisions of Article 12(4) RPBA were not pertinent in the present case.

[15] Taking into account the course of the first-instance proceedings, it is the board’s view that an admission of the main request into the appeal proceedings would be incompatible with the judicial nature of the appeal procedure […]. As set out above […], the appellant patent proprietor made a considered and deliberate choice not to respond in substance to the opposition at all in the first-instance proceedings but to defend its patent for the first time in appeal proceedings, by filing amended claims and corresponding arguments. In fact, it was only in the appeal proceedings that the [patent proprietor] for the first time took an active part after receipt of the opposition. As argued by the [opponent], the [patent proprietor] effectively circumvented the first instance and defended its patent exclusively in the appeal proceedings. By this conduct, the [patent proprietor] tried to shift its case entirely to the second instance, thereby compelling the board either to give a first ruling on the [patent proprietor’s] case or to remit the case to the OD. Such a shifting of the case would also put the [opponent] at an unjustified disadvantage because if the main request were admitted and decided upon by the board, the subject-matter of that request would have been dealt with only by the board and the [opponent] would be deprived of an examination of the claims before two instances.

[16] For the above reasons, the board, exercising its power under Article 12(4) RPBA, decided not to admit the [patent proprietor’s] main request into the appeal proceedings.

The [patent proprietor’s] auxiliary request for remittal

[17] At the OPs before the board the [patent proprietor’s] new representative requested, as an auxiliary measure, that the case be remitted to the OD on the basis of the amended set of claims which were filed with the statement of grounds of appeal and which form the basis for the [patent proprietor’s] main request.

[18] Although it is true that a remittal pursuant to A 111(1) EPC 1973 would avoid the loss of two instances, it would clearly be in contradiction to the board’s discretionary decision not to admit the main request into the appeal proceedings. In particular, it would go against the reasons which the board had for not admitting the [patent proprietor’s] main request into the appeal proceedings.

[19] As pointed out by the [opponent], a remittal would also be disadvantageous for the [opponent] since it would involve higher costs and a prolongation of the proceedings by several years before the present case would finally be settled. Moreover, the prospect of second appeal proceedings would not be excluded. Hence a remittal would go against the principles of procedural economy without any justification. Further a remittal would cause legal uncertainty for a long period for the [opponent], as well as for the public, regarding the validity of the opposed patent. The board accepts the argument of the [opponent], namely that, in the case of a remittal, the [opponent] and the public would be left with a provisionally valid patent for a considerable time until the issue of a final decision and, therefore, would have to be careful as far as possible infringements of the present patent were concerned.

[20] It is the board’s conviction that, even if it decided to remit the case to the OD, an order for a different apportionment of costs in the [opponent’s] favour would not offset the above disadvantages of a remittal.

[21] For the above reasons the [patent proprietor’s] auxiliary request is not allowable.

[22] Since none of the [patent proprietor’s] requests is allowable, the appeal must be dismissed.

Should you wish to download the whole decision, just click here.

The file wrapper can be found here.

Thursday, 26 July 2012

T 1870/08 – Disclaimer Subtleties


The present decision is extremely interesting because it tries to shed some light on the - complex, to say the least - interrelation between G 1/03 and G 2/10.

If you only want the headnote, here it is:
The test of G 2/10 also applies to an amendment involving an undisclosed disclaimer by means of which a claim has been rendered new over a European patent application according to A 54(3). The examination of the admissibility of the amendment for compliance with A 123(2) must be made separately for the disclaimer per se and for the subject-matter remaining in the claim (see point [4] of the Reasons).
But I would definitely recommend that you also read the reasoning behind this statement.

The appeal was filed by the opponent after the Opposition Division had maintained the opposed patent in amended form. The wording of independent claim 1 of the main request was as follows (board’s labelling):
(i) A superconducting wire comprising:
(ii) a tubular sheath member (2); and
(iii) an oxide superconductor (1) filled in said sheath member,
(iv) said sheath member being formed of a material resistant in an oxidizing atmosphere to oxidation at the temperature of heat treatment used to form said superconducting wire,
(v) said material being selected from Au, Ag or an alloy thereof and
(vi) when said sheath is Ag or an alloy thereof, said oxide superconductor is not of the K2NiF4 type.
In the following extract the Board examines the request with respect to the requirements of A 123(2):

[4.1] Claim 1 specifies that the sheath member is
  • filled with an oxide superconductor ( feature (iii)) and
  • formed of a material selected from Au, Ag or an alloy thereof (feature (v)).
Feature (vi) of claim 1 specifies that when said sheath is Ag or an alloy thereof, the oxide superconductor is not of the K2NiF4 type. The following subject-matter is therefore disclaimed:

The combination of
  • an oxide superconductor of the K2NiF4 type and 
  • a sheath made of Ag or an alloy thereof.
[4.2] The indication that the oxide superconductor is of the “K2NiF4 type” relates to the crystal structure of the superconductor and means that this structure is of the same type as that of potassium nickel fluoride K2NiF4.

In the application documents as originally filed it is disclosed […] that the oxide superconductor may have a perovskite type crystal structure. Furthermore, layered perovskite oxides and oxygen deficient perovskite oxides are mentioned. It is also disclosed that the sheath member contains a material selected from the group of: Ag, Au, Pt, Pd, and their alloys. Furthermore, combinations of specific superconducting compositions and specific sheath materials have been disclosed in the examples of the invention […].

However, the combination of an oxide superconductor of the K2NiF4 type and a sheath made of Ag or an alloy thereof is not disclosed as subject-matter of the invention or as a possible negative feature in the application as filed. The feature (vi) is therefore regarded to be an undisclosed disclaimer.

By means of the disclaimer (vi) the subject-matter of claim 1 has been rendered new over document D1, a European patent application according to A 54(3) […].

[4.2.1] The [opponent] argued that the disclaimer was inadmissible in the light of G 2/10. The disclaimer obviously had a technical effect, because Ag as mentioned in the disclaimer clearly had different physical properties from the other materials. For example, it was well known that Au and Ag had quite different melting temperatures, which could have a significant impact on their applicability as a sheath material. This technical teaching was not derivable from the application as filed. Hence, the subject-matter “remaining in the claim after the introduction of the disclaimer” would not pass the test as set out in G 2/10.

Disclaimers in the light of decision G 1/03

[4.3.1] Both referring decisions T 451/99 and T 507/99 leading to decision G 1/03 (and G 2/03) of the Enlarged Board of Appeal (EBA) posed the question whether an undisclosed disclaimer may be allowable when its purpose is to meet a lack-of-novelty objection pursuant to A 54(3) EPC 1973. This question is answered in the order of G 1/03.

A 54(3) is essentially equivalent to A 54(3) EPC 1973. Decision G 1/03 is therefore concerned with the same situation as in the present case and has to be considered carefully. This is especially the case in view of the board’s obligations under Article 21 RPBA (OJ EPO 2007, 536).

[4.3.2] G 1/03 [2.1] is of particular relevance in relation to state of the art under A 54(3). It was explained there that for a proper interpretation of the law the purpose of A 54(3) EPC 1973 had to be taken into account.

There followed a discussion of the two traditional solutions in Europe which dealt with the problem of how a later application should be affected by an earlier application which had not been published at the filing or priority date of the later application (“whole contents approach” vs. “prior claim approach”). The corresponding discussions in the preparatory work to the EPC were also mentioned. Although eventually the “whole contents approach” was, at least in principle, accepted for the EPC, it was qualified in important respects and could not be said to implement the “philosophical” basis of the “whole contents approach”, i.e. that nothing be patented that had already been disclosed to the patent office.

The legal history made it clear that the intention was to restrict the effect of the earlier application as far as possible in order to avoid unfairness resulting from the concept of a fictional publication. Furthermore, delimitation against an earlier application was a traditional and well-known exercise under the “prior claim approach” and it might be assumed that the highly controversial “whole contents approach” would never have been accepted in the preparatory work to the EPC if it had been suggested not only to extend the state of the art to be considered for novelty by a legal fiction but also to do away with the practice of delimitation against earlier applications.

For the interpretation of A 123(2) EPC 1973 it was deduced from the discussion on A 54(3) EPC 1973 that the purpose of the disclaimer excluding a conflicting application was merely to take account of the fact that different applicants were entitled to patents in respect of different aspects of inventive subject-matter and not to change the given technical teaching.

The following conclusion was reached:
“Such a disclaimer, only excluding subject-matter for legal reasons, is required to give effect to A 54(3) [1973] and has no bearing on the technical information in the application. It is, therefore, not in contradiction to A 123(2) [1973].” (point [2.1.3, second paragraph]).
As will be apparent below, the correct interpretation of the finding that an admissible disclaimer “has no bearing on the technical information in the application” is decisive for the question whether a claim may be found to infringe A 123(2).

[4.3.3] In the discussion on A 54(3) EPC 1973 cited above, reference is made (see G 1/03 [2.1.1]), inter alia, to A 54(4) EPC 1973. According to the transitional provisions under Article 7 of the Act revising the EPC of 29 November 2000 (Special edition No. 1, OJ EPO 2007, 197) in conjunction with Article 1, last sentence of the Decision of the Administrative Council of 28 June 2001 on the transitional provisions under Article 7 of the Act revising the European Patent Convention of 29 November 2000, A 54(4) EPC 1973 shall apply to patents already granted at the time of entry into force of the EPC 2000. Furthermore, A 123(2) is essentially equivalent to A 123(2) EPC 1973. The board therefore concludes that the reasoning of G 1/03 referred to above applies to the present case.

The decision G 2/10

[4.4.1] The [opponent] argued that the introduction of the disclaimer (vi) into claim 1 infringed A 123(2), especially in view of decision G 2/10 of the EBA.

In the referring decision T 1068/07 [14] leading to decision G 2/10 of the EBA it was held that the subject-matter of the disclaimer had been disclosed as an embodiment of the invention in the application as filed. This is also reflected in the question put to the EBA.

In G 2/10 [2.3] the term “embodiment” in the referred question was understood to be addressing the issue of disclaiming “subject-matter”, which is consequently reflected in the order of G 2/10. That decision therefore concerns an amendment to a claim by the introduction of a disclaimer disclaiming from it subject-matter disclosed in the application as filed.

The present case, by contrast, relates to an undisclosed disclaimer […]. Decision G 2/10 is therefore, prima facie, not concerned with the same situation as in the present case, so it may be questioned whether that decision is applicable at all to the present case.

[4.4.2] The [opponent] argued in particular that in order to decide whether the amendment introducing the disclaimer (vi) into claim 1 infringed A 123(2), the test set out [in] G 2/10 [4.5] had to be applied.

[4.4.3] This test, which in the following the board will refer to as the “test of G 2/10”, is that an amendment to a claim by the introduction of a disclaimer infringes A 123(2) if the subject-matter remaining in the claim after the introduction of the disclaimer is not, be it explicitly or implicitly, directly and unambiguously disclosed to the skilled person using common general knowledge, in the application as filed (see G 2/10 [order 1a; 4.5.1-2]). Determining whether or not that is the case requires a technical assessment of the overall technical circumstances of the individual case under consideration, taking into account the nature and extent of the disclosure in the application as filed, the nature and extent of the disclaimed subject-matter and its relationship with the subject-matter remaining in the claim after the amendment (see G 2/10 [order 1b; 4.5.3-5]).

[4.4.4] On the other hand, in G 1/03 the conclusion that the disclaimer was not in contradiction to A 123(2) EPC 1973 was based on essentially legal considerations, taking into account the purpose of A 54(3) EPC 1973 and having particular regard to the preparatory work to the EPC […]. Even though the notion of ‘remaining subject-matter’ is mentioned, how it should be determined or defined is not dealt with any further (see for example the last sentence of point [2.1.3]). Accordingly, it is not immediately apparent how, or to what extent, the test of G 2/10 should be applied to the present case, if applicable at all. For example, decision T 1049/08 held that G 2/10 applies exclusively to disclosed disclaimers (see point [4.4, 4th §]). At the same time the board is aware that some passages of G 2/10 strongly suggest otherwise, as explained hereafter.

[4.4.5] G 2/10 [4.7] discusses the President’s suggestion that, where the subject-matter remaining in the claim was not directly and unambiguously derivable from the application as filed, the criteria established in G 1/03 should be applied regarding the allowability of the disclaimer. This was suggested since otherwise, in the case of state of the art according to A 54(3) EPC 1973, an applicant disclaiming disclosed subject-matter could be in a worse position than an applicant disclaiming subject-matter for which there was no disclosure in the application.

[4.4.6] The EBA examined this question and held that this discrepancy does not exist. More importantly, it did not interpret decision G 1/03 “to have intended, in its answer 2, to exhaustively determine the conditions under which, if fulfilled, an amendment by introduction of an undisclosed disclaimer was to be regarded as allowable under A 123(2) under all circumstances.” It is, however, not explicitly stated in G 2/10 what other conditions had to be fulfilled for such an amendment to be allowable. On the other hand, there can be little doubt that in the opinion of the EBA, claims containing an undisclosed disclaimer may well be found to infringe A 123(2). This is most clearly seen from the last statement of point [4.7]:
“Hence, in that decision [i.e. G 1/03] it was not decided that, the requirements of answer 2 being fulfilled, an undisclosed disclaimer would always be allowable under A 123(2).”
Furthermore, from the overall context of the President’s proposal and the answer of the EBA, as described above, it appears that in the opinion of the EBA such an infringement of A 123(2) would have the same cause as in the case of the disclaimers disclaiming disclosed subject-matter, namely the lack of disclosure of the subject-matter remaining in the claim. In other words, the test of G 2/10 also applies for undisclosed disclaimers.

[4.4.7] This may convey the impression that the two decisions contradict, given that an undisclosed disclaimer – as part of the definition of the claimed subject-matter – could obviously not have been disclosed to the skilled person in the application as filed.

The board therefore needs to examine how the test as set out in G 2/10 is applicable in the present case without running counter to the ratio decidendi of G 1/03. In this the board also attaches considerable weight to the fact that in G 2/10 the EBA at no point states or suggests that the findings of G 1/03 are not valid, although this decision is analysed in great detail (G 2/10 [3, 4.3, 4.4]).

Applicability of the teaching of G 2/10 to the present case

[4.5.1] The question is whether the test of G 2/10 may in fact require that an undisclosed disclaimer, being part of the definition of the claimed subject-matter, also needs to have a basis in the application as filed.

This would mean that undisclosed disclaimers would no longer be possible. Such a conclusion would have required the EBA to have made a clear statement to this effect, which it did not, however, as observed above […].

[4.5.2] It therefore follows that in G 2/10 the EBA in fact meant something else. For this reason, the board is of the opinion that the above-cited last sentence of point [4.7] of the Reasons was intended to mean that it was not decided in G 1/03 that, the requirements of answer 2 of G 1/03 being fulfilled, an amendment involving an undisclosed disclaimer would always be allowable under A 123(2). A similar formulation is in fact also used by the EBA in the preceding paragraph: “… an amendment by introduction of an undisclosed disclaimer …” (G 2/10 [4.7, 4th §, second sentence]).

[4.5.3] This board believes that the EBA intended to refer to an amendment by which the addition of an undisclosed disclaimer results in an amended claim in which the subject-matter remaining in the claim after the amendment – but not the undisclosed disclaimer itself – needs to be examined for its compatibility with A 123(2). The question now remains as to how this examination should be done.

[4.5.4] Such an interpretation of G 2/10 makes it possible to maintain the crucial distinction between, on the one hand, the disclaimer per se, namely a feature of the claim which contributes to the definition of the claimed subject-matter, which may be itself allowable on the basis of G 1/03 even when undisclosed, and, on the other hand, the subject-matter remaining in the claim after the introduction of the disclaimer. The possibility of such a distinction is in line with the findings of G 1/03, and is not in contradiction with G 2/10, as will be explained hereafter. At the same time, the notion of the ‘subject-matter remaining in the claim’ makes sense independently of whether the disclaimer per se was disclosed or not. It is another matter that ascertaining compliance with A 123(2) may require a different examination, depending on whether the disclaimer was disclosed or not.

[4.5.5] Decision G 1/03 introduced the notion that the subject-matter remaining in the claim may well be defined and identified even without the subject-matter of the disclaimer per se, see G 1/03, [2.1.3, last sentence]:
“The remaining subject-matter is not modified by the disclaimer.”
This finding of the EBA is understood by the present board to mean that the disclaimer does not form part of the remaining subject-matter, in the sense that its technical effects – or more precisely any teaching which may possibly be derived from a technical analysis of the features used in the formulation of the disclaimer – must simply be disregarded when the claim is compared with the original teaching in the application as filed. It is another matter that the disclaimer is required to identify those possible embodiments of the original technical teaching which are no longer covered by the amended claim, but are nevertheless still covered by the original technical teaching, i.e. the original disclosure normally understood as defining the subject-matter for the purposes of A 123(2).

[4.5.6] The EBA at no point stated in G 2/10 that the distinction between disclaimers and other features of the claim is no longer tenable. On the contrary, the EBA confirmed that disclaimers are special in the sense that they are not to be considered as belonging to the invention, that is the technical subject-matter:
“By contrast, the technical subject-matter defined in the disclaimer does not make the disclaimed subject-matter as such a part of the definition of the claimed invention” (G 2/10, point [4.5.2, 2nd §]).

[4.5.7] It needs no particular emphasis that the use of undisclosed disclaimers may be quite common in certain technical areas, yet it must be considered as an exceptional tool in claim drafting. Its exceptional character is well illustrated by the fact that G 1/03 laid down strict conditions for its applicability. The board observes that the possibility of using undisclosed disclaimers has been derived from the legislative intent, and not from the wording of the EPC. Accordingly, such a possibility cannot and need not be explained on the basis of an interpretation which is derived only from the wording of the EPC. However, given that this latter interpretation is the basis of most proceedings before the EPO, care must be taken not to deviate from this “standard” interpretation of the Convention more than absolutely necessary. This explains the required exceptional approach to the examination of claim amendments involving undisclosed disclaimers as opposed to claim amendments involving disclosed features.

[4.5.8] A 123(2) refers to the subject-matter of an application or patent as a whole, which may not be amended beyond the original content of the application. The claim is part of the application, and therefore it appears natural that A 123(2) also applies to the subject-matter of the claim. The term “subject-matter” as used in the EPC mostly refers to the technical teaching of the invention. This is best illustrated by comparing the wording of paragraphs (2) and (3) of A 123, with the former referring to subject-matter as opposed to the (scope of) protection conferred.

[4.5.9] Furthermore, the patent system normally awards legal protection to the patent proprietor for exactly the subject-matter which had been disclosed as the invention, i.e. a technical solution. Even when the original full disclosure of an application is limited later in the light of the state of the art, it is to be expected that the remaining subject-matter can be qualified as a complete and fully disclosed invention. However, when “subject-matter” is considered as the “subject-matter of a claim”, it suddenly develops a legal dimension. Besides expressing the technical teaching of the invention (what has been taught by the inventor to solve a technical problem), it also defines the legal subject-matter, namely the legal scope of protection (what others are excluded from exploiting). These are assumed to be the same, by virtue of A 69(1) in conjunction with R 43(1) (R 29(1) EPC 1973), the latter requiring that the claims define the protection sought (i.e. the legal subject-matter) in terms of the technical features of the invention. Though not expressly stated in this Rule, it is of course presumed that here a possibly limited invention in conformity with A 123(2) is meant.

[4.5.10] The “subject-matter remaining in the claim” is doubtless also subject-matter of a claim, and as such it may also refer to both technical and legal subject-matter. As long as technical and legal subject-matter are the same, “subject-matter” may appear to be freely interchangeable between its technical and legal meaning. This is not the case when the subject-matter remaining in the claim results from an amendment by an undisclosed disclaimer.

[4.5.11] Indeed, in the case of a claim comprising such a disclaimer the scope of the technical and of the legal subject-matter may be different. The scope of protection sought is less than the scope as taught by the invention, through the use of the purely legal limitation which as such does not make the subject-matter defined by the disclaimer part of the definition of the claimed invention. From this it also follows that technical and legal subject-matter are no longer freely interchangeable. On the contrary, the notion ‘subject-matter remaining in the claim’ as used in G 1/03 and G 2/10 must be carefully examined at every stage to ascertain whether it refers to the technical or legal subject-matter.

[4.5.12] It appears to the board that it is unproblematic to read the concepts ‘subject-matter remaining in the claim’ and ‘subject-matter disclosed in the application as filed’ in the order of G 2/10 as technical subject-matter, i.e. the features of the invention as taught. This also holds true for the concept ‘disclaimed subject-matter’, given that it was the precondition of the referral for G 2/10 that the disclaimed subject-matter was disclosed in the application as filed.

[4.5.13] If, on the other hand, the order of the EBA in decision G 2/10 had to be read as also applying to a claim which has been amended by means of an (admissible) undisclosed disclaimer, as apparently suggested by the EBA (see point [4.4.6] above), then the meaning of the expression “subject-matter remaining in the claim after the introduction of the disclaimer” must inevitably change to legal subject-matter in certain instances, namely whenever the effects of the disclaimer are examined. Put simply, in order to avoid comparing apples and pears during the examination for compliance with A 123(2), one must always keep in mind that the purely legal subject-matter of the disclaimer cannot by definition modify the original technical subject-matter.

[4.5.14] Furthermore, if the disclaimer was undisclosed, it would not find any support in the sense of implicit or explicit disclosure in the application. Having anything undisclosed in a claim may not appear to be conform with A 123(2) according to its normal or usual interpretation, i.e. when all claim features, without exception, are expected to be directly and unambiguously derivable from the application as filed. However, assuming that A 123(2) only sets up a requirement for the technical subject-matter, while at the same time accepting that the disclaimer cannot modify the technical subject-matter, then it is not A 123(2) which is violated. Rather, claims containing (admissible) undisclosed disclaimers are exempted from complying with R 43(1), since the claim will contain features which might be technical per se, but they will not be those of the invention.

[4.5.15] In this case, the claimed subject-matter is not amended so as to extend beyond the original content when compared with the originally disclosed (technical) subject-matter of the application, because the disclaimer does not modify the teaching of the invention, as a matter of law: it is not part of the definition of the invention. It only exists in a legal sense: it provides the limitation which is solely intended to play a role when the scope of protection needs to be determined, but cannot be considered when the original technical merits of the invention are examined. However, this limiting effect in itself, i.e. the result of the limitation (but not the features which have resulted in the limitation), may still have an effect on the technical subject-matter, as will be illustrated below.

[4.5.16] Finally, it is mentioned that apart from the question of compliance with A 123(2) as prescribed by decision G 2/10, the amended claim, including the disclaimer, also needs to fulfil the other requirements laid down by G 1/03, such as clarity and conciseness (see point [2.4] of the order) and restriction of the amendment to the minimum (see point [2.2] of the order).

The test of G 2/10

[4.6.1] The exceptional character of an amendment by way of an undisclosed disclaimer, as explained above, dictates that the examination of the admissibility of such an amendment is made with due regard to this exceptional character. In particular, the examination of the admissibility of the amendment for compliance with A 123(2) must be made separately for the disclaimer per se and for the subject-matter remaining in the claim (see point [4.5.4] above).

[4.6.2] The examination must start with the question whether the formal conditions for the use of an undisclosed disclaimer as laid down in decision G 1/03 are given. In the present case this is uncontentious, because the disclaimer is intended to delimit the invention against a European patent application according to A 54(3).

It would appear wrong to the board first to examine any technical effect of the proposed disclaimer in order to decide on its admissibility, as proposed by the [opponent]. Most disclaimers are worded using technical terms, so that such an examination would inevitably find technical effects as a result of the technical terms used. This would consequently make all such disclaimers inadmissible, which could not have been the intention of the EBA in view of G 1/03. Accordingly, the arguments of the [opponent] cannot stand.

Furthermore, it appears wrong to the board to require at this stage in the examination of the proposed amendment that implicit or explicit support for the disclaimer per se should be found in the application as filed. As stated above, this would automatically disqualify all undisclosed disclaimers.

[4.6.3] The test as laid down in decision G 2/10 should thus take place after an examination of the legal preconditions for admitting the use of undisclosed disclaimers according to G 1/03 and after the insertion of the proposed disclaimer in the claim. It is only at this stage that the examination of the “subject-matter remaining in the claim” should be made, corresponding to the order of G 2/10. This procedure is not in contradiction to the findings and the order of G 2/10: the subject-matter remaining in the claim “after the introduction of the disclaimer” must be examined (see point 1a of the order of G 2/10). The wording of the order leaves it open whether the disclaimer per se must fulfil A 123(2) or not.

[4.6.4] There is also nothing in G 2/10 itself which would imply the contrary. Similar formulations are used throughout the decision, e.g.: “Whether the skilled person is presented with new information depends on how he or she would understand the amended claim” (emphasis by the board, see point [4.5.2, 3rd §]). This board only adds that the skilled person, when reading the amended claim, is expected to be aware that the claim contains an undisclosed disclaimer, given that G 1/03 instructs that undisclosed disclaimers must be drafted so that they are readily identifiable as such (see [3, last §]). Therefore, the skilled person will be able to read the claim keeping in mind the differences between the technical and legal subject-matter, as explained above (see point [4.5.9]). Other board decisions have also readily accepted that the remaining subject-matter can be examined independently of whether there is any basis for the disclaimer itself (see for example T 1107/06 [45]).

[4.6.5] Again, in the opinion of this board, the order of decision G 2/10 not only makes it clear that the test which it lays down applies to the amended claim, but the test is also applicable to amendments involving an undisclosed disclaimer. It is true that point 1b of the order concentrates on the examination of the technical content: determining whether or not the amendment infringes A 123(2) “requires a technical assessment of the overall technical circumstances of the individual case under consideration”. The emphasis put on the technical content is understandable given that the referrals plainly concerned disclaimers apparently not benefiting from the special status of admissible undisclosed disclaimers. Yet the order does not imply that the disclaimer per se needs to have a basis in the application as filed. Rather, the above determination of whether or not the amendment infringes A 123(2) should be made “taking into account the nature and extent of the disclosure in the application as filed, the nature and extent of the disclaimed subject-matter and its relationship with the subject-matter remaining in the claim after the amendment” (see point 1b of the order).

[4.6.6] Put differently, the test of G 2/10 can be used for examining the remaining subject-matter with due regard to the fact that the disclaimer is an undisclosed one that, as such, does not add technical subject-matter as a matter of law. As explained above, given that the skilled person is aware that the undisclosed disclaimer needs to be treated as such, the skilled person will also be able to determine whether the technical subject-matter remaining within the legal scope of the claim has been properly disclosed as required by G 2/10.

[4.6.7] This said, the Board now needs to determine how the requirement for the amended claim to meet the test of G 2/10 may possibly be satisfied.

In the first place, it must be examined whether the proposed disclaimer is indeed a proper disclaimer, in the sense that the remaining legal subject-matter is less than that of the unamended claim. If any subject-matter can be identified which falls within the scope of the claim after amendment by the proposed disclaimer, but which did not do so before the amendment, the disclaimer is improper. For example, a negative formulation removing a restricting feature may look like a disclaimer, but may in fact extend the legal scope of protection. The board takes it that such an amendment, not being a disclaimer at all, would also fail the test of G 1/03 so that any further examination under G 2/10 would in fact be redundant.

Secondly, it may be examined whether there is any remaining subject-matter at all. A comparison of the originally disclosed and remaining subject-matter may reveal that a proper interpretation of the disclaimer in fact leaves the amended claim empty, in the sense that no technically realistic or feasible embodiments can be identified on the basis of the original application which would still fall under the amended claim.

Thirdly, even if the second examination is passed, it may still be justified to examine whether the remaining subject-matter could plausibly be considered as belonging to the invention as presented in the application. For example, some existing remaining subject-matter may well be positively identified purely on the basis of claim logic. Nevertheless, a technical assessment of the original application may show that the amended claim is restricted to such a combination of parameters which the skilled person would never have contemplated as belonging to the invention from a technical point of view, for example because it would not solve the technical problem underlying the original invention.

It must be emphasized that these types of examinations are given only as examples potentially suitable for determining whether the remaining subject-matter can be considered as properly disclosed in the sense of G 2/10. It goes without saying that other types of examinations may offer themselves, depending on the technical content of the application and the proposed disclaimer.

The present case

[4.7.1] In the present case, the board is satisfied that the subject-matter remaining in the claim has been properly disclosed and that the [patent proprietor] is not benefiting from an unwarranted advantage as a result of the amendment (G 1/93 [9]).

[4.7.2] In particular, in the application documents as originally filed it is disclosed […] that the oxide superconductor may have a perovskite type crystal structure in the broad sense. This comprises structures which are not of the K2NiF4 type, which was also known to the person skilled in the art of superconductor technology at the priority date. For instance, in example 10 […] a superconducting wire is disclosed in which the components were mixed at a mixing ratio of (Y0.4Ba0.6)CuO3, which is not of the disclaimed type. Furthermore, it is disclosed […] that the sheath member contains a material selected from the group of: Ag, Au, Pt, Pd, and their alloys.

From the priority document JP56856/87 of 13.03.1987 […] it can also be derived that the oxide superconductor has a perovskite type crystal structure which is not of the K2NiF4 type as described above, and that the sheath member is composed of Ag, Au or an alloy thereof.

Thus it is clear that there are genuine and realistic embodiments still encompassed by the amended claim. Furthermore, there is no pointer in the application or any evidence on file that the embodiments still covered by the claim would not provide the advantages of the invention or that the skilled person could not have reproduced them at the priority date. Put differently, there is no pointer in the application for not considering these embodiments as belonging to the invention.

[4.7.3] Accordingly, the board is satisfied that the technical subject-matter remaining in the claim has been properly disclosed to the skilled person in the application as filed. The board is also satisfied that the disclaimer is clear and concise, and properly restricted in relation to the anticipating content of European patent application D1. For these reasons the board is of the opinion that the amendment introducing the disclaimer (vi) into claim 1 is not contrary to the requirements of A 123(2), and is allowable in the light of both G 1/03 and G 2/10.

To download the whole decision, click here.

The file wrapper can be found here.